View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_83 (Length: 286)
Name: NF1836_low_83
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 133 - 274
Target Start/End: Complemental strand, 12682278 - 12682137
Alignment:
| Q |
133 |
accaaggctttgttcacttgcatggacataggtatccccggtggcacgtgcatggtcatcggcataacttttatagccgatacatcttctatttccggtt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12682278 |
accaaggctttgttcacttgcatggacataggtatccccggtggcacgtgcatggtcatcggcataacttttatcgccgatacatcttctatttccggtt |
12682179 |
T |
|
| Q |
233 |
cttctttcggctctccaagagtgagatcaatgtttgtagaat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682178 |
cttctttcggctctccaagagtgagatcaatgtttgtagaat |
12682137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 12682397 - 12682352
Alignment:
| Q |
20 |
ggcctcgaccctcgacttttgtgtgacggtcttttgtagatgatct |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682397 |
ggcctcgaccctcgacttttgtgtgacggtcttttgtagatgatct |
12682352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University