View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_85 (Length: 281)
Name: NF1836_low_85
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 46824345 - 46824613
Alignment:
| Q |
1 |
aattcaaatgtttgagtatttattaatgatgactgcatctaaaatttcttgaaaacgaaagaaaagaaaactggttatcatctctagagaacttttttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46824345 |
aattcaaatgtttgagtatttattaatgatgactgcatctaaaatttcttgaaaacgaaagaaaagaaaacaggttatcatctctagagaacttttttat |
46824444 |
T |
 |
| Q |
101 |
ttcctttgatgggttggttgttggaattcttcctt--nnnnnnnnnntccggttttcgg-aaaaaatggacattgttaatccggaatttgatcaagggtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46824445 |
ttcctttgatgggttggttgttggaattcttttttcattgttaaacatccggttttcggaaaaaaatggacattgttaatccggaatttgatcgagggtt |
46824544 |
T |
 |
| Q |
198 |
aggttttaactaacggtcgcggtctcggtcgccgccgtgttaaggttttcgcgattttagatgtcacag |
266 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
46824545 |
aggttttaactaacggttgcggtctcggtcgcggccgtgttaatgttttcgcgatttcagatgttacag |
46824613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 254
Target Start/End: Original strand, 21315474 - 21315530
Alignment:
| Q |
198 |
aggttttaactaacggtcgcggtctcggtcgccgccgtgttaaggttttcgcgattt |
254 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
21315474 |
aggttttaaataacggtcacggtctcggtcgcggtcgcgttaaggttttcgcgattt |
21315530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University