View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18370_low_3 (Length: 302)
Name: NF18370_low_3
Description: NF18370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18370_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 179 - 258
Target Start/End: Original strand, 30367004 - 30367083
Alignment:
| Q |
179 |
ttcttcatttacttctactattggcgacacaatggcggtgaaattatgccgaaatggccaatagttggtatgctactgtc |
258 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30367004 |
ttcttcatttacatctactataggcgacacaatggcggtgagattatgccgaattggccaatagttggtatgctattgtc |
30367083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 258
Target Start/End: Complemental strand, 31376787 - 31376712
Alignment:
| Q |
183 |
tcatttacttctactattggcgacacaatggcggtgaaattatgccgaaatggccaatagttggtatgctactgtc |
258 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
31376787 |
tcatttacatctactattggcgacacaatggcggtgagattatgatgaattggccaatagttggtatgctactgtc |
31376712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 31397704 - 31397758
Alignment:
| Q |
19 |
actagatatgtattttaatcccaaaagcaaactctagttgaattcaatacttatat |
74 |
Q |
| |
|
||||||| |||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31397704 |
actagatttgtattttaatcg-aaaagcaaattctagttgaattcaatacttatat |
31397758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 173
Target Start/End: Original strand, 31397810 - 31397856
Alignment:
| Q |
127 |
ctacatcagtaaggttcgttagaaaaattagactgctctacctgcca |
173 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
31397810 |
ctacatcagtcaggttggttccaaaaattagactgctctacctgcca |
31397856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University