View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18371_high_29 (Length: 251)
Name: NF18371_high_29
Description: NF18371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18371_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 22039531 - 22039283
Alignment:
| Q |
1 |
taagctagcattgctcttgcctttatatagtgatagttaattcatggatttcatccataaataataatttaatgaatgggtcaactgccttgttcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22039531 |
taagctagcattgctcttgcctttatatagtgatagttaattcatggatttcatccataaataataatttaatgaatgggtcaattgccttgttcaacaa |
22039432 |
T |
 |
| Q |
101 |
gctcaaaatttcgaaaataaaatattcaatgcttataaagaatta--------------gtaaagttaatatcgaagaagcttccttcagttcctcacct |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22039431 |
gctcaaaatttcgaaaataaaatattcaatgcttataaagaattagtaataacttgttggtaaagttaatatcgaagaagcttccttcagttcctcacct |
22039332 |
T |
 |
| Q |
187 |
tcatttgttaattaatcgtggcatgtccgccccaccatatcgcacttgc |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22039331 |
tcattttttaattaatcgtggcatgtccgccccaccacatcgcacttgc |
22039283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University