View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18371_high_34 (Length: 235)
Name: NF18371_high_34
Description: NF18371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18371_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 39979434 - 39979221
Alignment:
| Q |
1 |
cattctagtaaattgtaatctctgccattaaaccaataaagttgtgaatttgccattttctaatgccattgtgatttgtgaagccatgctagtccatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979434 |
cattctagtaaattgtaatctctgccattaaaccaataaagttgtgaatttgccattttctaatgccattgtgatttgtgaagccatgctagtccatcat |
39979335 |
T |
|
| Q |
101 |
cgactaaattgtgaaaattctgatgagctagctacaaaacatagtagtgtatgattgcaacatgttcttcctgaagagaggataagaggagatagccaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979334 |
cgactaaattgtgaaaattctgatgagct--ctacaaaacatagtagtgtatgattgcaacatgttcttcctgaagagaggataagaggagatagccaca |
39979237 |
T |
|
| Q |
201 |
ctttagacaaaatgat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39979236 |
ctttagacaaaatgat |
39979221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University