View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18371_low_25 (Length: 280)
Name: NF18371_low_25
Description: NF18371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18371_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 29002948 - 29002794
Alignment:
| Q |
14 |
tactcaaactcaacaaaaaataatacaacatatttattctctcaaataagatgaaagtaatttagcaaatcttcacacaattacacatcattgaatagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002948 |
tactcaaactcaacaaaaaataatacaacatatttattctctcaaataagatgaaagtaatttagcaaatcttcacacaattacacatcattgaatagaa |
29002849 |
T |
|
| Q |
114 |
ccaaaccctatcatgaactttatttgcttcatgcgtctacactcgatgttaagag |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002848 |
ccaaaccctatcatgaactttatttgcttcatgcgtctacactcgatgttaagag |
29002794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 251
Target Start/End: Complemental strand, 29002587 - 29002518
Alignment:
| Q |
182 |
cttgctccattttaacttgttagcctcccaatcaatccatcaacaattctattgtatttgtttgaacaaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29002587 |
cttgctcccttttaacttgttagcctcacaatcaatccaccaacaattctattgtatttgtttgaacaaa |
29002518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University