View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18371_low_28 (Length: 261)
Name: NF18371_low_28
Description: NF18371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18371_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 246
Target Start/End: Original strand, 8577528 - 8577774
Alignment:
| Q |
9 |
gaagaatatgatggtagctggaatgatctctccaaaactcttattgttctcaaatttgtgcttctcacttatttatactacaacttatctaggttaagct |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8577528 |
gaagaaaatgatggtagctggaatgatctctccaaaactcttattgttctcaaatgtgtgcttctcacttatttatactacaactcatctaggttaagct |
8577627 |
T |
 |
| Q |
109 |
ccattgttaat----tgaggaaaattctaaattttgtatagtaggtggaat-----gnnnnnnntaatggttgtacaatcctgcagagtttgttacaact |
199 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8577628 |
ccattgttaattaaatgaggaaaattccaaattttgtatagtaggtggaatgaaaagaaaaaaaaaatggttgtacaatcctgcagagtttgttacaact |
8577727 |
T |
 |
| Q |
200 |
aaagaggtgttgccatgtggttactgcttttcctttcacttgcatat |
246 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8577728 |
aaagaggtgtggccatgtggttactgcttttcctttcacttgcatat |
8577774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 8597415 - 8597349
Alignment:
| Q |
177 |
atcctgcagagtttgttacaactaaagaggtgttgccatgtggttactgcttttcctttcacttgca |
243 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
8597415 |
atcctgcagagtttgttacaacgaaagaggtgtggccatgtggttactgctttgcctttcacttgca |
8597349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 47 - 84
Target Start/End: Complemental strand, 8597451 - 8597414
Alignment:
| Q |
47 |
tcttattgttctcaaatttgtgcttctcacttatttat |
84 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
8597451 |
tcttaatgttctcaaatgtgtgcttctcacttatttat |
8597414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University