View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18371_low_32 (Length: 247)
Name: NF18371_low_32
Description: NF18371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18371_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 4 - 233
Target Start/End: Complemental strand, 54080568 - 54080339
Alignment:
| Q |
4 |
acagctcatctcatggttataggtgaggtagggattttgtctgtgcaccagaaagtctactttttgttttgccaatagtggtggtgccactgtcagttcc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54080568 |
acagctcatctcatggttataggtgaggtagggattttgtctgtgcaccagaaagtctactttttgttttgccaatagtggtggtgccactgtcagtctc |
54080469 |
T |
 |
| Q |
104 |
ctaagttttgtataaggtaatagtggtatatatatcattaactttttgttgcatggtgaccaatttgcacttagattactatatctaggtgttcattctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080468 |
ctaagttttgtataaggtaatagtggtatatatatcattaactttttgttgcatggtgaccaatttgcacttagattactatatctaggtgttcattctt |
54080369 |
T |
 |
| Q |
204 |
atacatggttcaagaatgctattatattta |
233 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
54080368 |
atacaaggttcaagaatgctattatattta |
54080339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 109 - 228
Target Start/End: Complemental strand, 54083669 - 54083555
Alignment:
| Q |
109 |
ttttgtataaggtaatagtggtatatatatcattaactttttgttgcatggtgaccaatttgcacttagattactatatctaggtgttcattcttataca |
208 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| |||| |||||||||| | |
|
|
| T |
54083669 |
ttttgtataagctagtagtggt----atatcattaactttttgttgcatgatgatcaatttgcacctagattactatatct-ggtgctcattcttatgga |
54083575 |
T |
 |
| Q |
209 |
tggttcaagaatgctattat |
228 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
54083574 |
aggttcaagaatgcttttat |
54083555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University