View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18373_high_5 (Length: 510)
Name: NF18373_high_5
Description: NF18373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18373_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 269
Target Start/End: Complemental strand, 13430150 - 13429899
Alignment:
| Q |
19 |
acccgttggtcatctctttgctgctatttcaacttatcaacctatcattatcactgaactccagaacttttatgtttcacatttggtggtaacagttttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13430150 |
acccgttggtcatctctttgctgctatttcaacttatcaacctatcattatcactgaactccagaacttttatgtttcacatttggtggtaacagttttt |
13430051 |
T |
|
| Q |
119 |
gctagtaatttcagcattccaaataattgtttgttttctagcaagtggttttgtatgacaaagataggattttaattccacaattcacaagtttgaaaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
13430050 |
gctagtaatttcagcattccaaataattgtttgttttctagcaagtggttttgtatgacaaagataagattttaattccacaattgacaagtttgaaaca |
13429951 |
T |
|
| Q |
219 |
tgttatgcttcataattacatggttcccctcag-ggggtgacttcggctcgc |
269 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13429950 |
tgttatgcttcagaattacatggttcccctcaggggggtgacttcggctcgc |
13429899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 268 - 350
Target Start/End: Complemental strand, 13429407 - 13429328
Alignment:
| Q |
268 |
gcaacaactaacatccatccatttttctaaaagcaccgaacatggaacaagaaattctcttgaataagaattagtacactcgg |
350 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| | |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13429407 |
gcaacaattaacatccatccatttttccaaaagcac---atatggaacaagaaatcctcttgaataagaattagtacactcgg |
13429328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 435 - 465
Target Start/End: Complemental strand, 13429201 - 13429171
Alignment:
| Q |
435 |
tagacatgtatgatctaatgattgaattttc |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13429201 |
tagacatgtatgatctaatgattgaattttc |
13429171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University