View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18373_high_9 (Length: 236)
Name: NF18373_high_9
Description: NF18373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18373_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 3446881 - 3447100
Alignment:
| Q |
1 |
gctagagccggttcggttgacctgaccccagttcggcttgcaggagcaattcccatccatcctgggtttgtcaggtcataccgaagccggtctgaaattg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446881 |
gctagagctggttcggttgacctgaccccagttcggcttgcaggagcaattcccatccatcctgggtttgtcaggtcataccgaagccggtctgaaattg |
3446980 |
T |
|
| Q |
101 |
aaatgccacaatcaccatttctaacattggatatgttggacaagttcttgggcttggcactaccaattgggagcaacaaggaccaccccttcacatgccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3446981 |
aaatgccacaatcaccatttctaacattggatatgttggacaagttcttgggcttggcactaccaattgggagcaacaaggatcaccccttcacatgccc |
3447080 |
T |
|
| Q |
201 |
gatgggctcgggggcaccac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3447081 |
gatgggctcgggggcaccac |
3447100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University