View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_high_39 (Length: 224)
Name: NF18374_high_39
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 41440452 - 41440649
Alignment:
| Q |
14 |
gcaaagggaatggtgttaattaattgtatgcatgtacaagtgtcccttactttacttgagagcaaggagcagtggagtggtaatatctaactaaagtagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41440452 |
gcaaagggaatggtgttaattaattgtatgcatgtacaagtgtcccttactttacttgagagcaaggagcagtggagtggtaatatctaactaaagtagg |
41440551 |
T |
|
| Q |
114 |
aaacaattccatataacagggcaaggaatttgataaagtttcat-----actgcacatgctcttgctagctgtaccttccccttgtcttattctttac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41440552 |
aaacaattccatataacagggcaaggaatttgataaagtttcatactgcactgcacatgctcttgctagctgtaccttccccttgtcttattctttac |
41440649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University