View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_high_45 (Length: 209)
Name: NF18374_high_45
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 18498604 - 18498780
Alignment:
| Q |
11 |
aggagcacagaggcttcaatctaaaatctagagatttagattgggtagatttccactcaactcgctaacattaggagcttaagaagagaagtgtgcaaga |
110 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18498604 |
aggaacaccgaggcttcattctaaaatctagagatttagattgggtagatttccactcaactcgctaacattgggagcttaagaagagaagtgtgcaaga |
18498703 |
T |
|
| Q |
111 |
tggttgtagatggaaagcttggtcaggaagtaaccgatggaaaaggtcagtggtaagccaaagcagcaggttagtga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18498704 |
tggttgtagatggaaagcttggtcaggaagtaaccgatggaaaaggtcagtggtaagccaaagcagcaggttagtga |
18498780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University