View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_low_27 (Length: 295)
Name: NF18374_low_27
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 166 - 280
Target Start/End: Complemental strand, 7752681 - 7752567
Alignment:
| Q |
166 |
ctataatgtgtaatcacttttgcagatatcctcatcaataatgacaggaagcctttttcttgtctcaatagcattctatcttgaggttagttaggtaatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7752681 |
ctataatgtgtaatcacttttgcagatatcctcatcaataatgacaggaagcctttttcttgtctcaatagcattctattttgaggttagttaggtaatt |
7752582 |
T |
|
| Q |
266 |
attcaaagttgattc |
280 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7752581 |
attcaaagttgattc |
7752567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 7752840 - 7752742
Alignment:
| Q |
1 |
ttcagttatcataatcagctttttcttctaggtcatagttactggaatcactacttggttggtggacaaaagtggaagaaggctacttctaatagttaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752840 |
ttcagttatcataatcagctttttcttctaggtcatagttactggaatcactacttggttggtggacaaaagtggaagaaggctacttctaatagttaa |
7752742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 197 - 281
Target Start/End: Complemental strand, 7823526 - 7823442
Alignment:
| Q |
197 |
tcatcaataatgacaggaagcctttttcttgtctcaatagcattctatcttgaggttagttaggtaattattcaaagttgattct |
281 |
Q |
| |
|
||||| ||||||| ||||||| |||||||||| |||||||||||||||||||| |||| |||| |||| |||| | ||||||||| |
|
|
| T |
7823526 |
tcatctataatgataggaagcttttttcttgtttcaatagcattctatcttgacgttatttagctaatcattcgaggttgattct |
7823442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 75
Target Start/End: Original strand, 32932079 - 32932145
Alignment:
| Q |
9 |
tcataatcagctttttcttctaggtcatagttactggaatcactacttggttggtggacaaaagtgg |
75 |
Q |
| |
|
|||||||||| || | ||| ||||||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32932079 |
tcataatcagtattcttttccaggtcatagctactggagtagctacttggttggtggacaaaagtgg |
32932145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University