View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_low_31 (Length: 275)
Name: NF18374_low_31
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 45787612 - 45787864
Alignment:
| Q |
1 |
gatgaggaagtagaggtgaggttttctcattgatgaaggtctgggaaatttgttgttacgtgaataagatgatggatccatcgtattcagtagaaactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45787612 |
gatgaggaagtagaggtgaggttttctcattgatgaaggtctgggaaatttgttgttacgtgaataagatgatggatccatcgtattcagtagaaactat |
45787711 |
T |
|
| Q |
101 |
caagactgaagaaagtgattcttggaatttagaattggtttaggtttagggcttgatttaa-tttagatgtatatataattttcagtctctggtttttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45787712 |
caagactgaagaaagtgattcttggaatttagaattggtttaggtttagggcttgatttaattttagatgtatatataattttcagtctctggtttttct |
45787811 |
T |
|
| Q |
200 |
ttcttcagattgaaatggaacgcgtttgggctatggaagaaaaaggttgtaat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45787812 |
ttcttcagattgaaatggaacgcgtttgggctatggaagaaaaaggttgtaat |
45787864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University