View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_low_39 (Length: 236)
Name: NF18374_low_39
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38556437 - 38556215
Alignment:
| Q |
1 |
gtcctatctgggagagatgaggctcaatgtcttcatgatgagtatcagcaagttgtgggcgttgagccagcacccaacgtccatcttcagtcttcaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556437 |
gtcctatctgggagagatgaggctcaatgtcttcatgatgagtatcagcaagttgtgggcgttgagccagcacccaacgtccatcttcagtcttcaccat |
38556338 |
T |
 |
| Q |
101 |
attcctattcaaat-cttgcctccaatttggtggcacagagtgctcatctttcacaaagtcacaagccttattcaccaaagcaatgtccctattagtggt |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556337 |
attcctattcaaatatttgcctccaatttggtggcacagagtgctcatctttcacaaagtcacaagccttattcaccaaagcaatgtccctattagtggt |
38556238 |
T |
 |
| Q |
200 |
tgcttcatatccacggttgctcc |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38556237 |
tgcttcatatccacggttgctcc |
38556215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38548337 - 38548116
Alignment:
| Q |
1 |
gtcctatctgggagagatgaggctcaatgtcttcatgatgagtatcagcaagttgtgggcgttgagccagcacccaacgtccatcttcagtcttcaccat |
100 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||||||||||||||| ||| ||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38548337 |
gtcctatctgggagagatgtggttcaaggtcttcatgatgagtatcaacaacttgtgggcgatgagccagcatccaacgtccatcttcagtcttcaccat |
38548238 |
T |
 |
| Q |
101 |
attcctattcaaatcttgcctccaatttggtggcacagagtgctcatctttcacaaagtcacaagccttattcaccaaagcaatgtccctattagtggtt |
200 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||| |
|
|
| T |
38548237 |
atttctgttcaaatcttgcctccaatttggtggcacatagtgttcatctttcacaaagtcacaagacttattcaccaaagcaatgtccctatcagttgtt |
38548138 |
T |
 |
| Q |
201 |
gcttcatatccacggttgctcc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38548137 |
gcttcatatccacggttgctcc |
38548116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University