View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_low_43 (Length: 222)
Name: NF18374_low_43
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_low_43 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 34254322 - 34254545
Alignment:
| Q |
1 |
atttcccgttactcttaattgagttttatttccttaattcctttgctgtaaaaatctatcatttatcccatgattactggttgaactaagtagacaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34254322 |
atttcccgttactcttaattgagttttatttccttaattcctttgctgtaaaaatctatcatttatcccatgattactggttgaactaagtagacaaatt |
34254421 |
T |
|
| Q |
101 |
gtggagtcagttagggatgttgctatgctgaacttaagctacttatgaattatgaaatgattgtgtc--nnnnnnnnnnnnngaattatgaaatgacatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
34254422 |
gtggagtcagttagggatgttgctatgctgaacttaagctacttatgaattattaaatgattgtgtcaaaaaaaaaaaaaaagaattatgaaatgacatt |
34254521 |
T |
|
| Q |
199 |
ctcaaagccagtaatgcctgataa |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34254522 |
ctcaaagccagtaatgcctgataa |
34254545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University