View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18374_low_46 (Length: 211)

Name: NF18374_low_46
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18374_low_46
NF18374_low_46
[»] chr8 (1 HSPs)
chr8 (81-193)||(12682615-12682727)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 81 - 193
Target Start/End: Complemental strand, 12682727 - 12682615
Alignment:
81 ttaaaccggttgaaacagaaacagtggtgtcgtttatatctacgtaagcactgtttgatggtcgtttacgtttctttttctcaggtgattcatcggattg 180  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12682727 ttaaaccggatgaaacagaaacagtggtgtcgtttatatctacgtaagcactgtttgatggtcgtttacgtttctttttctcaggtgattcatcggattg 12682628  T
181 ttggtttggttct 193  Q
    |||||||||||||    
12682627 ttggtttggttct 12682615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University