View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_low_46 (Length: 211)
Name: NF18374_low_46
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 81 - 193
Target Start/End: Complemental strand, 12682727 - 12682615
Alignment:
| Q |
81 |
ttaaaccggttgaaacagaaacagtggtgtcgtttatatctacgtaagcactgtttgatggtcgtttacgtttctttttctcaggtgattcatcggattg |
180 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682727 |
ttaaaccggatgaaacagaaacagtggtgtcgtttatatctacgtaagcactgtttgatggtcgtttacgtttctttttctcaggtgattcatcggattg |
12682628 |
T |
 |
| Q |
181 |
ttggtttggttct |
193 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12682627 |
ttggtttggttct |
12682615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University