View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18374_low_47 (Length: 211)
Name: NF18374_low_47
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18374_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 126 - 196
Target Start/End: Complemental strand, 38296826 - 38296756
Alignment:
| Q |
126 |
caatagggtgtgttgttgtcatggcttttaactacttgtagtgctgccnnnnnnngacagacttctctgtg |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38296826 |
caatagggtgtgttgctgtcatggcttttaactacttgtagtgctgcctttttttgacagacttctctgtg |
38296756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University