View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18375_high_20 (Length: 240)
Name: NF18375_high_20
Description: NF18375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18375_high_20 |
 |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 14015081 - 14015287
Alignment:
| Q |
15 |
atgaacaacatggatttacttttgatacctctcaggaatatgatagttaaagaaaccatggtttctattcactatctattaaaaattagcccaggcatta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14015081 |
atgaacaacatggatttacttttgatacctctcaggaatatgatagttaaagaaaccatggtttctattcactatctaataaaaattagcccaggcatta |
14015180 |
T |
 |
| Q |
115 |
ctataggaaagaaactcaacataattcaagacaagttgcttcattgatgtctctaatggatcttagaccaagacgtcccccattcatagaagagcaaacc |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14015181 |
ctattggaaagaaactcaacataattcaagaaaagttgcttcattgatgtctctaatggatcttagaccaagacctcccccattcatagaagagcaaacc |
14015280 |
T |
 |
| Q |
215 |
ttgtgct |
221 |
Q |
| |
|
||||||| |
|
|
| T |
14015281 |
ttgtgct |
14015287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 202
Target Start/End: Complemental strand, 27352 - 27281
Alignment:
| Q |
131 |
caacataattcaagacaagttgcttcattgatgtctctaatggatcttagaccaagacgtcccccattcata |
202 |
Q |
| |
|
|||||||||| |||| || ||| ||| |||||||||||||||||||| ||| |||||| |||| | |||||| |
|
|
| T |
27352 |
caacataattaaagagaaattgtttcgttgatgtctctaatggatctgagatcaagacctccctctttcata |
27281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University