View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18375_low_16 (Length: 253)
Name: NF18375_low_16
Description: NF18375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18375_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 2 - 237
Target Start/End: Original strand, 151990 - 152225
Alignment:
| Q |
2 |
atatataacgatatacgtcatgtatattatttgagataaacttgtacgagtctatgaactcacaaatacatgtttgtttctttcacaaattgcttgttta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151990 |
atatataacgatatacgtcatgtatattatttgagataaacttgtacgagtctatgaactcacaaatacatgtttgtttctttcacaaattgcttgttta |
152089 |
T |
 |
| Q |
102 |
aattgaaaaaacagcaatttaaatttgcacaaacatgtaacgcggattcaatttaaatttgatttgatatgctatagtgcaaatttgaatcagctttaca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
152090 |
aattgaaaaaacagcaatttaaatttgcacaaacatgtaacgcggattcaatttaaatttgatttgatatgctatagtgcaaatttgaatccgctttaca |
152189 |
T |
 |
| Q |
202 |
tcttttctatacacttagtgtgtgttcttggctact |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
152190 |
tcttttctatacacttagtgtgtgttcttggctact |
152225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University