View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18376_high_6 (Length: 269)
Name: NF18376_high_6
Description: NF18376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18376_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 14527512 - 14527273
Alignment:
| Q |
19 |
ttggagtacctcatgaagcatccggtgttgagcgcccgtccttctgacgagggcagacatctcaaaatagaagatgatgcatgctcgagacatgctttgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14527512 |
ttggagtacctcatgaagcatccggtgttgagcgcccgtccttctgacgagggcagacatctcaaaatagaagatgacgcatgctcgagacatgctttgc |
14527413 |
T |
 |
| Q |
119 |
aagacttagaatccaaacttctctaacaatcagccagaacataagcagattcattcgatgttcctgatacaactactttccctctggcatagcctttatt |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527412 |
aagacttagaatccaaacttctccaacaatcagccagaacataagcagattcattcgatgttcctgatacaactactttccctctggcatagcctttatt |
14527313 |
T |
 |
| Q |
219 |
tttcggtgcatctcgaaccgctc-ttaacactgcctcctt |
257 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14527312 |
tttcggtgcatctcgaaccgctctttaacactgcctcctt |
14527273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University