View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18377_low_12 (Length: 209)
Name: NF18377_low_12
Description: NF18377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18377_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 12364942 - 12365072
Alignment:
| Q |
18 |
gttaatcctgatggtaaaaccattactagctcatgcctccatcattaagaattttcctcaagggataaattcttcatgctcactatcccaactcaaagaa |
117 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12364942 |
gttaatcctcatggtaaaaccattaccagctcatgcctccatcattaagaattttcctcctgggataaatttttcatgctcactatcccaactcaaagaa |
12365041 |
T |
|
| Q |
118 |
tatgctagaaacaacctttattcctttatgg |
148 |
Q |
| |
|
||||| ||||||||||||| || |||||||| |
|
|
| T |
12365042 |
tatgccagaaacaaccttttttactttatgg |
12365072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University