View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18378_high_13 (Length: 220)
Name: NF18378_high_13
Description: NF18378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18378_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 2549659 - 2549472
Alignment:
| Q |
15 |
cataggatgtgccaaacatactagttatactatgcaatgttttggtcgtcttcttttttatttcatgcgcttttggtgtctcttccatgtttggtcaaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
2549659 |
cataggatgtgccaaacatactagttatagtatgcaat-ttttggtcgtcttcttttttatttcatacgcttttggtgtctcttccatgtttggtcgaac |
2549561 |
T |
|
| Q |
115 |
aacaggtgcaatgaaggagaatgacttcagcataaattttgtaacacccgctattcaataatacgtatcttattattatgagtttgtatct |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
2549560 |
aacaggttcaatgaaggagaatgacttcagcataaattttgtaacacccgc--ttcaaaaatacatatcttattattatgagtttgtatct |
2549472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University