View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18378_low_14 (Length: 220)

Name: NF18378_low_14
Description: NF18378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18378_low_14
NF18378_low_14
[»] chr3 (1 HSPs)
chr3 (15-205)||(2549472-2549659)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 2549659 - 2549472
Alignment:
15 cataggatgtgccaaacatactagttatactatgcaatgttttggtcgtcttcttttttatttcatgcgcttttggtgtctcttccatgtttggtcaaac 114  Q
    ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||    
2549659 cataggatgtgccaaacatactagttatagtatgcaat-ttttggtcgtcttcttttttatttcatacgcttttggtgtctcttccatgtttggtcgaac 2549561  T
115 aacaggtgcaatgaaggagaatgacttcagcataaattttgtaacacccgctattcaataatacgtatcttattattatgagtttgtatct 205  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||| ||||| ||||||||||||||||||||||||||    
2549560 aacaggttcaatgaaggagaatgacttcagcataaattttgtaacacccgc--ttcaaaaatacatatcttattattatgagtttgtatct 2549472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University