View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18378_low_3 (Length: 518)
Name: NF18378_low_3
Description: NF18378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18378_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 299
Target Start/End: Complemental strand, 25110116 - 25109827
Alignment:
| Q |
11 |
cataggcaaaagcagacgtaaaaatgggtttaaaactcattcgggtcaaagattcacaagtcactagaggtggcaaggagacc-atgacattagttttct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25110116 |
cataggcaaaagcagacgtaaaaatgggtttaaaactcattcgggtcaaagattcacaagtcactagaggtggcaaggagacccatgacattagttttct |
25110017 |
T |
 |
| Q |
110 |
ttatcaagaacggagaggacttgtggaagttggtatgagtgtttgggacgatgtgataatgttcctaaagtgatcgtgttggacgatcttgacacgattt |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25110016 |
ttatcaagaacgaagaggacttgtggaagttggtatgagtgtttgggacgttgtgatattgttcctaaagtcatcgtgttggacgatcttgacacgattt |
25109917 |
T |
 |
| Q |
210 |
agatatttctttaagagaagttgttggctaaattgcacttcttgcataggatgctcccgttcatgacataccccttcaaatccacgttga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25109916 |
agatatttctttaagagaagttgttggctaaattgcacttcttgcataggatgctcccgttcatgacataccccttcaaatccacgttga |
25109827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University