View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18378_low_9 (Length: 300)
Name: NF18378_low_9
Description: NF18378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18378_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 98 - 264
Target Start/End: Original strand, 27761773 - 27761939
Alignment:
| Q |
98 |
aggctcctttcccttgtatcctagctggcgttgatgtagatgtattcgcgggtagactatttttagagacaatttggttttgcacttctgttttggactt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27761773 |
aggctcctttcccttgtatcctagctggtgttgatgtagatgtatttgcgggtagactatttttagagacaatttggttttgcacttctgttttggtctt |
27761872 |
T |
 |
| Q |
198 |
tcgccctcgtataccttcaacatcaggctcctttcctttggtttggcttcttgctgtgtggctttgt |
264 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27761873 |
tcgccctcgtataccttcagcatcaggctcctttcctttggtttggcttcttgctgtgcggctttgt |
27761939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 27756749 - 27756841
Alignment:
| Q |
1 |
aaagaactcagttgtgcagattttcttcgttcttgttcccttgtatacacaatctttagtgcacttgtaactgaatggttcaatggtagctaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27756749 |
aaagaactcagttgtgcagattttcttcgttcttgttcccttgtatacacaatctttagtgcacttgtaactgaatggttcaatggtagctaa |
27756841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University