View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1837_low_12 (Length: 222)
Name: NF1837_low_12
Description: NF1837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1837_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 13708134 - 13708332
Alignment:
| Q |
11 |
attatactataattttggaatgcgaaagaacagttttttgaagcttaatgagcaacttttttattctaaagtggtatcgtgccatggcccaattagaaag |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13708134 |
attatactataattttggaatgcaaaagaacagttttttgaagcttaatgagcaactttcttattctaaagtggtatcgtgccatggcccaattagaaag |
13708233 |
T |
 |
| Q |
111 |
ttcgtgaatggaagaaaataaaattgacaattagaga----gttttccctctctaatttaagatcttttttagtagtgctaatcattccatggcaaaat |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13708234 |
ttcgtgaatggaagaaaaaaaaattgacaattagagagcttgttttccctctctaatttaagatcttttttagtagtgctagtcattccatggcaaaat |
13708332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University