View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1837_low_13 (Length: 219)
Name: NF1837_low_13
Description: NF1837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1837_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 27723077 - 27723265
Alignment:
| Q |
15 |
ctgtgattggaatctaattttgtgtttgattacgcggtatcaatgctacaaatagtcctttgacaaattacggggaattttcatatcgatgatagaatga |
114 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27723077 |
ctgtaattgaaatctaattttgtctttgattacgcggtatcaacgctacaaatagtcctttgacaaattacggggaattttcatatcgatgatagaatga |
27723176 |
T |
 |
| Q |
115 |
catgcagaagacacgttcaaacaagcaccaagtcaaccagcaattgtaaattaactgtactagaatctgaggttctcactcctgtttct |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27723177 |
catgcagaagacacgtccaaacaagcaccaagtcaaccagcaattgtaaattaactgtactagaatctgaggttctcactcctgtttct |
27723265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University