View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1837_low_8 (Length: 251)
Name: NF1837_low_8
Description: NF1837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1837_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 9828498 - 9828671
Alignment:
| Q |
1 |
tgtagagaaaatatggtgaccgtacctagagggaagaccccctgttgatcttatggctccaaagtgacactttgatggttgttgctatcatcatgttgaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
9828498 |
tgtagagaaaatatggtgatcgtacctagagggaagaccccctgttgatcttatggctccaaagtgacaccttgatggttgttgccatcatcatgttgaa |
9828597 |
T |
 |
| Q |
101 |
cttgtataagataagctaagttgtaatggaaaactgaatccgagataaacaatagcacttatcatatttgaata |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9828598 |
cttgtataagataagctaagttgttatggaaaactgaatccgagataaacaatagcacttatcatatttgaata |
9828671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 176 - 235
Target Start/End: Original strand, 9828748 - 9828806
Alignment:
| Q |
176 |
gttgaacttttgttgttgggcaaatctaattccttcgaagtgagctttcattgttggatc |
235 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
9828748 |
gttgaacttttgttattgggcaaatctaatgccttccaagtgagc-ttcattgttggatc |
9828806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University