View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1837_low_9 (Length: 237)
Name: NF1837_low_9
Description: NF1837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1837_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 9059005 - 9058785
Alignment:
| Q |
2 |
ggtatttttgttatcagaacgagttgcacaaaatatcataatgatatcgtaattttgttgaatctataatgtgtatacttattttacaatatcaagatga |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
9059005 |
ggtatttttgttatcagaacgagttgaacaaaatatcataatgatatcgtaattttgttgaatctataaagtgtatatttattttgcaatatcaagatga |
9058906 |
T |
 |
| Q |
102 |
accaacatgannnnnnn-cagctcagtgtgatatcaaagaaagaattggaaagactagcttcaattagaaagtttgtacaactttaaaattttagatgat |
200 |
Q |
| |
|
|||||||| | || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9058905 |
accaacattattttttttcaactcagtgtgatatgaaagaaagaattggaaagactagcttcaattagaaagtttgtacaactttaaaattttagatgat |
9058806 |
T |
 |
| Q |
201 |
taaagtgaggttgcatttatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9058805 |
taaagtgaggttgcatttatg |
9058785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University