View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_high_14 (Length: 437)
Name: NF18380_high_14
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 3e-21; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 362 - 421
Target Start/End: Original strand, 46450020 - 46450080
Alignment:
| Q |
362 |
tatcacttggatgcatgcatagtctgtttgataccatacagggag-actactaaagtgaag |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46450020 |
tatcacttggatgcatgcatagtctgtttgataccatacagggagaactactaaagtgaag |
46450080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 327 - 364
Target Start/End: Original strand, 46449944 - 46449981
Alignment:
| Q |
327 |
aacaacattgatgaggggaggttcaaacttcaaactat |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449944 |
aacaacattgatgaggggaggttcaaacttcaaactat |
46449981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 273
Target Start/End: Original strand, 46449905 - 46449941
Alignment:
| Q |
237 |
tataatactagtatgcagctagctagttacaattaat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449905 |
tataatactagtatgcagctagctagttacaattaat |
46449941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 270 - 342
Target Start/End: Original strand, 46438426 - 46438499
Alignment:
| Q |
270 |
taatgcagttttatttatgtttgcatcaattttga-agtttcttattatgatggtcaaaacaacattgatgagg |
342 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| || | | ||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
46438426 |
taatgcagttttatatatgtttgcataaatttggagaatatcttattataatggtcaaaataacatcgatgagg |
46438499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University