View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_high_16 (Length: 422)
Name: NF18380_high_16
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 153 - 288
Target Start/End: Complemental strand, 19506161 - 19506026
Alignment:
| Q |
153 |
ggttacgtgcgataagcatatggttatgtcggtttcaatttcacgtatcaatatagagtttaagatggagtctatgtttcaactaggaagcactattatg |
252 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19506161 |
ggtttcgtgcgataagcatatggttatgtcggtttcaatttcacgtatcaatatagagtttaagatggagtctatgtttcaactaggaaccactattatg |
19506062 |
T |
 |
| Q |
253 |
aatggtttctgatatatcaattacaattaggattga |
288 |
Q |
| |
|
||||| || | ||||||||||| ||||||||||||| |
|
|
| T |
19506061 |
aatggcttttaatatatcaattgcaattaggattga |
19506026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 19506243 - 19506155
Alignment:
| Q |
18 |
ctaaagcgataaagattacaatcagtttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506243 |
ctaaagcgataaagattacaatcagtttttgtccttctgtgcttttatttacgaaaacaaatttagttttcggcatgaattcggtttcg |
19506155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 318 - 374
Target Start/End: Original strand, 629814 - 629870
Alignment:
| Q |
318 |
attttcgtaatgatactagattgcaggattttgtggagaaagatatcagcgatcaaa |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629814 |
attttcgtaatgatactagattgcaggattttgtggagaaagatatcagcgatcaaa |
629870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 375 - 417
Target Start/End: Original strand, 629982 - 630024
Alignment:
| Q |
375 |
aagtgcaggaagttttcttactctcgaggttatctgtgctcct |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
629982 |
aagtgcaggaagttttcttactctcgaggttatcagtggtcct |
630024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 44 - 110
Target Start/End: Original strand, 20568697 - 20568763
Alignment:
| Q |
44 |
ttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcggcta |
110 |
Q |
| |
|
|||||| |||||||| ||| ||| ||||||| ||||||||||||| || |||||| ||||||||||| |
|
|
| T |
20568697 |
ttttgttcttctgtggtttaattcacgaaaataaatttagttttcagcctgaatttggtttcggcta |
20568763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University