View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18380_high_36 (Length: 271)

Name: NF18380_high_36
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18380_high_36
NF18380_high_36
[»] chr6 (1 HSPs)
chr6 (192-257)||(7241671-7241736)


Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 192 - 257
Target Start/End: Original strand, 7241671 - 7241736
Alignment:
192 cattgtaagaaaacacctgcggatgcgtcttctgggttgtcacctatgccaatttcatttgatatt 257  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7241671 cattgtaagaaaacacctgcggatgcgtcttctgggttgtcacctatgccaatttcatttgatatt 7241736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University