View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_high_36 (Length: 271)
Name: NF18380_high_36
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 192 - 257
Target Start/End: Original strand, 7241671 - 7241736
Alignment:
| Q |
192 |
cattgtaagaaaacacctgcggatgcgtcttctgggttgtcacctatgccaatttcatttgatatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7241671 |
cattgtaagaaaacacctgcggatgcgtcttctgggttgtcacctatgccaatttcatttgatatt |
7241736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University