View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_high_41 (Length: 253)
Name: NF18380_high_41
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 3 - 248
Target Start/End: Original strand, 982883 - 983128
Alignment:
| Q |
3 |
ttggaagaaggagcaaaaagtgtgatgaattcaaagatgaagggtgctggaaaccaaagcagtaaagatatgattttcagagctgatagaattgatctca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
982883 |
ttggaagaaggagcaaaaagtgtgatgaattcaaagatgaagggtgctggaaaccaaagcagtaaagatatgattttcagagctgatagaattgatctca |
982982 |
T |
|
| Q |
103 |
agaatttggatgctcaattggaaaagcacttaagccgggtttggtcaagaaacaccaatgagacaaaaaggcctagagaagaatgggaggttgagttggc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
982983 |
agaatttggatgctcaattggaaaagcacttaagccgggtttggtcaagaaacaccaatgagacaaaaaggcctagagaagaatgggaggttgagttggc |
983082 |
T |
|
| Q |
203 |
caaattggatttaaggtatgttgttgctcatggtgcctatgctact |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
983083 |
caaattggatttaaggtatgttgttgctcatggtgcttatggtact |
983128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 50 - 116
Target Start/End: Original strand, 46734025 - 46734091
Alignment:
| Q |
50 |
tggaaaccaaagcagtaaagatatgattttcagagctgatagaattgatctcaagaatttggatgct |
116 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
46734025 |
tggaaatctaagcagtaaagatatgattttcagagctgatagaattgatctgaagaacttggatgct |
46734091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University