View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_high_47 (Length: 238)
Name: NF18380_high_47
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 982744 - 982588
Alignment:
| Q |
65 |
acacatgcatatataaaaaattgatcagagcaccccaaaagtatgttctttgatatatccttcctagacaattgacttcacatgtttcaaatttcacaga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
982744 |
acacatgcatatataaaaaattgatcagagcaccccaaaagtatgttctttgatatatccttcctagacaattgacttcacatgattcaaatttcacaga |
982645 |
T |
|
| Q |
165 |
attttctcctcaccaaccaatttgttttgttgactatgaaaaattctcaccagaata |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
982644 |
attttctcctcaccaaccaatttgttttgttgactatgaaaaattctcaccagaata |
982588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University