View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_high_55 (Length: 210)
Name: NF18380_high_55
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_high_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 9105556 - 9105737
Alignment:
| Q |
18 |
catctcactttcgataggctgcatattcttctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctttttgacaggttgagcattc |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9105556 |
catctcactttcggtaggctgcatattcttctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctttttgacaggttgagcattc |
9105655 |
T |
|
| Q |
118 |
ttctcgctttgttgaggagttgattgatcaccaatttgtctattagtcactctctttttggcaggttgagtattcttctctc |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9105656 |
ttctcgctttgttgaggagctgattgatcaccaatttgtctattattcactctctttttggcaggttgagtattcttctctc |
9105737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 94 - 194
Target Start/End: Original strand, 9105707 - 9105804
Alignment:
| Q |
94 |
ctctttttgacaggttgagcattcttctcgctttgttgaggagttgattgatcaccaatttgtctattagtcactctctttttggcaggttgagtattct |
193 |
Q |
| |
|
||||||||| ||||||||| ||||||||| | ||||||||||||| | ||||||||||||||||| |||| |||||||||||||| |||| ||||| |
|
|
| T |
9105707 |
ctctttttggcaggttgagtattcttctctccgtgttgaggagttggtgaatcaccaatttgtctat---tcaccctctttttggcaggctgagcattct |
9105803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 149
Target Start/End: Original strand, 9105778 - 9105834
Alignment:
| Q |
93 |
cctctttttgacaggttgagcattcttctcgctttgttgaggagttgattgatcacc |
149 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||| |||||| |||| ||||||| |
|
|
| T |
9105778 |
cctctttttggcaggctgagcattcttatcgctttgtggaggagctgatggatcacc |
9105834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 32 - 149
Target Start/End: Complemental strand, 41076252 - 41076135
Alignment:
| Q |
32 |
taggctgcatattcttctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctttttgacaggttgagcattcttctcgctttgttg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||| | | | | |||||||||| || |||||||| |||| ||||||||| | |
|
|
| T |
41076252 |
taggctgcatattcttctctttgtgttgaggagctgatgaatcaccaatttgtctattgaccctctttttggcaagttgagcaatcttatcgctttgtgg |
41076153 |
T |
|
| Q |
132 |
aggagttgattgatcacc |
149 |
Q |
| |
|
||||| |||| ||||||| |
|
|
| T |
41076152 |
aggagctgatggatcacc |
41076135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 98
Target Start/End: Original strand, 22819905 - 22819971
Alignment:
| Q |
31 |
ataggctgcatattcttctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctt |
98 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |||||||| ||| ||||| |||| |||||| |
|
|
| T |
22819905 |
atagtctgcatattcttctctttatgttgaggagctggtgaattaccaat-actttactcaccctctt |
22819971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University