View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_low_43 (Length: 246)
Name: NF18380_low_43
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 70 - 231
Target Start/End: Complemental strand, 49820168 - 49820007
Alignment:
| Q |
70 |
tgtgctaacatcaagagaacttatttgaaggtgaagattatttttcaacttcatatgcatactagtcatgtcatctaggagtccaccaccccctggacca |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49820168 |
tgtgctaacatcaagagaacttatttgcaggtgaagattatttttcaacttcatatgcatactagtcatgtcatctaggagtccaccaccccctggacca |
49820069 |
T |
 |
| Q |
170 |
ctacaagttaactaaactatgatggtgttttggtgcaacaatcaggcatatagcatcttgtg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49820068 |
ctacaagttaactaaactatgatggtgttgtggtgcaacaatcaggcatatagcatcttgtg |
49820007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 69
Target Start/End: Complemental strand, 49820256 - 49820197
Alignment:
| Q |
10 |
aaatgaatgaatgaattggatggattttgataataatagatggatggactggactagata |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49820256 |
aaatgaatgaatgaattggatggattttgataataatagatggatggactggactagata |
49820197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University