View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_low_47 (Length: 239)
Name: NF18380_low_47
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 40796354 - 40796186
Alignment:
| Q |
18 |
aaatgcaataagacagataatagtttatgtaaaatattgagtattgaataaaacgcaattataagcatacataaactagcatcttaatttgtcgagaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40796354 |
aaatgcaataagacagataatagtttatgtaaaatattgagtattgaatgaaacgcaattgtaagcatacataaactagcatcttaatttgtcgagaaac |
40796255 |
T |
 |
| Q |
118 |
tcaaaatattcagaatcaaatgttgaagcagttctgagttgtcggtaacagtttgaatcaattgaaatt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40796254 |
tcaaaatattcagaatcaaatgttgaagcagttctgagttgtcggtaacagtttgaatcaattgaaatt |
40796186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 40796154 - 40796107
Alignment:
| Q |
192 |
aaaatattgcaaggtgtttagggcaaaataaaatttcattatagagtt |
239 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40796154 |
aaaatattgcaaggtgtttagagcaaaataaaatttcattatagagtt |
40796107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University