View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_low_50 (Length: 235)
Name: NF18380_low_50
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 4650710 - 4650664
Alignment:
| Q |
14 |
cacagagggagagccacattcactcaacaacaaaaattgtcattgag |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4650710 |
cacagagggagagccacattcactcaacaacaaaaattgtcattgag |
4650664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 4650556 - 4650508
Alignment:
| Q |
168 |
cgtgaccgtgagagatgtgatcgccggcaacgagcaaccccagctattt |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4650556 |
cgtgactgtgagagatgtgatcgccggcaaagagcaaccccagctattt |
4650508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University