View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_low_57 (Length: 205)
Name: NF18380_low_57
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 31204209 - 31204382
Alignment:
| Q |
18 |
ctttgatacagcagaagttgaagtgaggatagtttgatgggttaagggaattaaaacttgtgtgaatgatggttatggaaaaaccatttgagtaaaggat |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31204209 |
ctttgatacaacagaagttgaagtgaggatagtttgatgggttaagggaattaaaacttgtgtgaatgatggttatggaaaaaccatttgagtaaaggat |
31204308 |
T |
|
| Q |
118 |
ttgtgcaagttgaagcattggatttatgtgtccttgtaatggtaaagggataagtaacaatctacaaccctttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31204309 |
ttgtgcaagttgaagcattggatttatgtgtccttgtaatggtaaagggataagtaacaatctacaaccctttg |
31204382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 159
Target Start/End: Original strand, 30848202 - 30848234
Alignment:
| Q |
127 |
ttgaagcattggatttatgtgtccttgtaatgg |
159 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
30848202 |
ttgaagcattggatttatgtgaccttgtaatgg |
30848234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University