View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18380_low_58 (Length: 204)

Name: NF18380_low_58
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18380_low_58
NF18380_low_58
[»] chr1 (2 HSPs)
chr1 (118-204)||(3098494-3098579)
chr1 (118-204)||(3092407-3092490)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 3098579 - 3098494
Alignment:
118 tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatctta 204  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3098579 tctagacggtgactgctttgtatt-gcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatctta 3098494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 3092490 - 3092407
Alignment:
118 tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatctta 204  Q
    |||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| ||| |||||   |||||||||||||||||||    
3092490 tctagatggtgattgctttgtttttgcagctgctaaatgattgttggaaagcattcagaagtgaa---agtacacaatcaaatctta 3092407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University