View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18380_low_58 (Length: 204)
Name: NF18380_low_58
Description: NF18380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18380_low_58 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 3098579 - 3098494
Alignment:
| Q |
118 |
tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatctta |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098579 |
tctagacggtgactgctttgtatt-gcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatctta |
3098494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 3092490 - 3092407
Alignment:
| Q |
118 |
tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatctta |
204 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
3092490 |
tctagatggtgattgctttgtttttgcagctgctaaatgattgttggaaagcattcagaagtgaa---agtacacaatcaaatctta |
3092407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University