View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18381_low_12 (Length: 285)
Name: NF18381_low_12
Description: NF18381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18381_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 54 - 263
Target Start/End: Complemental strand, 44693437 - 44693228
Alignment:
| Q |
54 |
acagctgctaactgcacagaacacaccagcccaaaaactgacagcagccaccagccaaactgcaacataacaggaggcaaaaaccagcacagaacatcca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44693437 |
acagctgctaactgcacagaacacaccagcccaaaaactgacagcagccaccagccaaactgcaacataacaggaggcaaaaaccagcacagaacatcca |
44693338 |
T |
 |
| Q |
154 |
gcaccactgagacggaatcaaccccgaaaaccagacaaccagcgaaggaaaaccagacagaaaacgataccttcagcagacaaaccaaacagcacaaaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44693337 |
gcaccactgagacggaatcaaccccgaaaaccagacaactagcgaaggaaaaccagacagaaaacgataccttcagcagacaaaccaaacagcacaaaaa |
44693238 |
T |
 |
| Q |
254 |
caactatctc |
263 |
Q |
| |
|
|||||||||| |
|
|
| T |
44693237 |
caactatctc |
44693228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University