View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18381_low_14 (Length: 269)
Name: NF18381_low_14
Description: NF18381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18381_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 53318583 - 53318851
Alignment:
| Q |
1 |
ccatttacctggcatgagctcgcttgttggaaacaaactccgcagcatatcttctctttcaacaagaaattggtcggcagaaagagaatcgctgatccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53318583 |
ccatttacctggcatgagctcgcttgttggaaacaaactccgcagcatatcttctctttcaacaagaaattggtcggcagaaagagaatcgctgatccca |
53318682 |
T |
 |
| Q |
101 |
gtctcttcaacaaaaaccttagcagcatcaattgctttcattcccatcatcttagccttgagaggccattcaaaggttttattgtatctagcaagtataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53318683 |
gtctcttcaacaaaaaccttagcagcttcaattgctttcattcccatcatcttagccttgagaggccattcaaaggttttattgtatctagcaagtataa |
53318782 |
T |
 |
| Q |
201 |
tttcttgaacttcagtatagaacttctccgtgtctgcaataataatcataataatatcatgaaattcgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53318783 |
tttcttgaacttcagtatagaacttctccgtgtctgcaataataatcataataatatcatgaaattcgt |
53318851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University