View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18382_high_2 (Length: 381)

Name: NF18382_high_2
Description: NF18382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18382_high_2
NF18382_high_2
[»] chr8 (2 HSPs)
chr8 (16-235)||(37251476-37251704)
chr8 (287-327)||(37242326-37242366)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 37251704 - 37251476
Alignment:
16 gtaatgagtgtgatgaagcagttgaatgttaaggttaaaccgaggaggaatgggaggaagatgatgaatacttcaagttgatgcatggtgctaaatgtga 115  Q
    ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
37251704 gtaatgagtgtgacgaagcagttgaatgttagggttaaaccgaggaggaatgggaggaagatgatgagtacttcaagttgatgcatggtgctaaatgtga 37251605  T
116 gatgtgaattaaagtgttatgtttgcaatcttttataaactcttatgatgggtatctgacctttat---------tcctttttattacggtgatagtgag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||    
37251604 gatgtgaattaaagtgttatgtttgcaatcttttataaactcttatgatgggtatctgacctttatgacctttactcctttttattacggtgatagtgag 37251505  T
207 aggagatggttagccttaaatacatttca 235  Q
    |||||||||||||||||||||| ||||||    
37251504 aggagatggttagccttaaatatatttca 37251476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 37242366 - 37242326
Alignment:
287 tgtccaacttaccaaatttgcttatgtggtctgacttgacc 327  Q
    ||||||||| ||||||||||||||||||| |||||||||||    
37242366 tgtccaactaaccaaatttgcttatgtggcctgacttgacc 37242326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University