View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18382_high_2 (Length: 381)
Name: NF18382_high_2
Description: NF18382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18382_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 37251704 - 37251476
Alignment:
| Q |
16 |
gtaatgagtgtgatgaagcagttgaatgttaaggttaaaccgaggaggaatgggaggaagatgatgaatacttcaagttgatgcatggtgctaaatgtga |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37251704 |
gtaatgagtgtgacgaagcagttgaatgttagggttaaaccgaggaggaatgggaggaagatgatgagtacttcaagttgatgcatggtgctaaatgtga |
37251605 |
T |
|
| Q |
116 |
gatgtgaattaaagtgttatgtttgcaatcttttataaactcttatgatgggtatctgacctttat---------tcctttttattacggtgatagtgag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37251604 |
gatgtgaattaaagtgttatgtttgcaatcttttataaactcttatgatgggtatctgacctttatgacctttactcctttttattacggtgatagtgag |
37251505 |
T |
|
| Q |
207 |
aggagatggttagccttaaatacatttca |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
37251504 |
aggagatggttagccttaaatatatttca |
37251476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 37242366 - 37242326
Alignment:
| Q |
287 |
tgtccaacttaccaaatttgcttatgtggtctgacttgacc |
327 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
37242366 |
tgtccaactaaccaaatttgcttatgtggcctgacttgacc |
37242326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University