View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18382_low_6 (Length: 212)
Name: NF18382_low_6
Description: NF18382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18382_low_6 |
 |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0441 (1 HSPs) |
 |  |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 21)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 22527818 - 22527931
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaactaaaatctcagttttttcccgtgtggatttctcaaagaagaatgagacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22527818 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacaacaaaactaaaatcttagttttttcccgtgtggatttctcaaagaagaatgagacg |
22527917 |
T |
 |
| Q |
118 |
atatccatggcagg |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22527918 |
atatccatggcagg |
22527931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 128 - 182
Target Start/End: Original strand, 22528647 - 22528701
Alignment:
| Q |
128 |
caggtgtggacatccggacagaggtttggtagcgtctgatctcaaaatctaattc |
182 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528647 |
caggtgtggacattcgggcagaggtttggtagcgtctgatctcaaaatctaattc |
22528701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 1832278 - 1832228
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1832278 |
gatgtattgctttgccgatttgcatgattttttcgtgaattacatcaaaac |
1832228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 20828364 - 20828317
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
20828364 |
gatgtcttgctttgccgatttgcatgatttcttcgtgaattacatcaa |
20828317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 18447664 - 18447614
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
18447664 |
gatgtcttgcttttccgatttgcatgatttgttcgtgaattacattaaaac |
18447614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 9849926 - 9849882
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
9849926 |
ttgctttgccgatttgcatgatttcttcgtgaattacataaaaac |
9849882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 68
Target Start/End: Complemental strand, 19547266 - 19547226
Alignment:
| Q |
28 |
tttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
19547266 |
tttgccgatttgcatgatttcttcttgaattacatcaaaac |
19547226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 25118086 - 25118042
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
25118086 |
ttgctttgtcgatttgcatgatttcttcttgaattacatcaaaac |
25118042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 16669945 - 16669906
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaatt |
58 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
16669945 |
atgtcttgctttgccgatatgcatgattttttcgtgaatt |
16669906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Complemental strand, 19335429 - 19335386
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
19335429 |
ttgctttaccgatttgcatgatttcttcttgaattacatcaaaa |
19335386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 4616942 - 4616988
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
4616942 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
4616988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 7613608 - 7613658
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||| || ||||||| |
|
|
| T |
7613608 |
gatgttttgctttgccgatttgcatgatttcttcttgaatcacgtcaaaac |
7613658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 11252349 - 11252303
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
11252349 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
11252303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 17661834 - 17661872
Alignment:
| Q |
30 |
tgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
17661834 |
tgccgatttgcatgatttcttcttgaattacatcaaaac |
17661872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 17711182 - 17711228
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
17711182 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
17711228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 12836290 - 12836241
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||| |||||||||| || |||||||| | |||||| |
|
|
| T |
12836290 |
atgtcttgctttgccgatatgcatgatttctttatgaattagaacaaaac |
12836241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 14573325 - 14573370
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
14573325 |
tcttgctttgacgatttgcatgatttctttgtgaattacatcaaaa |
14573370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 9053879 - 9053927
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||| || |||||||||||| |
|
|
| T |
9053879 |
atgtcttactttgctgatttgcatgatttcttcgtgcattacatcaaaa |
9053927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 15046774 - 15046727
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
15046774 |
gatgtcttgctttgccgatttgc---atttcttcctgaattacatcaaaac |
15046727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 15107650 - 15107697
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
15107650 |
gatgtcttgctttgccgatttgc---atttcttcctgaattacatcaaaac |
15107697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 25024989 - 25025029
Alignment:
| Q |
28 |
tttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
25024989 |
tttgccgatttgcatgatttcttcgtgaattacataaaaac |
25025029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 19)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 21079945 - 21079895
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
21079945 |
gatgtcttgctttgccgatttgcatgatttcttcttgaattacatcaaaac |
21079895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 27961086 - 27961136
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
27961086 |
gatgtctttctttgccgatttgcatgatttcttcgtgaattacatcaaaac |
27961136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 9339202 - 9339153
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
9339202 |
gatgtcttgctttgcagatttgaatgatttcttcatgaattacatcaaaa |
9339153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 10505043 - 10505092
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
10505043 |
gatgtcttgttttgccgatttgcatgatttcttcgtgaattacatcaaaa |
10505092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 30356136 - 30356185
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
30356136 |
atgtcttgctttgccgatttgcatgatttctccgtgaattacatcaaaac |
30356185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 20404229 - 20404185
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
20404229 |
ttgctttgccgatttgcatgatttcttcgtgaattacatcaaaac |
20404185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 3358015 - 3358065
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
3358015 |
gatgtctttctttgccgatttgcatgatttcttcacgaattacgtcaaaac |
3358065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 32759841 - 32759891
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
32759841 |
gatgtcttacattgccgatttgcatgatttcttcgtgaattacatcaaaac |
32759891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 10822110 - 10822158
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
10822110 |
atgtcttgctttgccgatttgcatgatttcttcgt-aattacatcaaaac |
10822158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 20723481 - 20723522
Alignment:
| Q |
26 |
gctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
20723481 |
gctttgccgatttgcatgattttatcttgaattacatcaaaa |
20723522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 9848041 - 9848084
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
9848041 |
ttgctttgccgatatgcatgattttttcgtgaattacttcaaaa |
9848084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 15600639 - 15600589
Alignment:
| Q |
18 |
gatgtcttgctttgcc-gatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
15600639 |
gatgtcttgctttgcctgatttgcataatttcttcgtgaattacatcaaaa |
15600589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 21060628 - 21060578
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||| || |||| |||||||| ||| |||||||||||||||| |
|
|
| T |
21060628 |
gatgtcttgctttcccaatttacatgatttcttcttgaattacatcaaaac |
21060578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 11136800 - 11136837
Alignment:
| Q |
30 |
tgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
11136800 |
tgccgatttgcatgatttattcatgaattacttcaaaa |
11136837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 17822246 - 17822201
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
17822246 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
17822201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 18171473 - 18171436
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaatta |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
18171473 |
tcttgatttgccgatttgcatgatttcttcatgaatta |
18171436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 22411625 - 22411580
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
22411625 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
22411580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 22564775 - 22564727
Alignment:
| Q |
18 |
gatgtctt-gctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
22564775 |
gatgtcttagctttgtcgatttgcatgatttcttcgtgaattacatcaa |
22564727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 67
Target Start/End: Complemental strand, 23644533 - 23644493
Alignment:
| Q |
27 |
ctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
23644533 |
ctttgcggatttgcatgatttcttcgtgaattacatcaaaa |
23644493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 23)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 17980665 - 17980714
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17980665 |
gatgtcttgatttgccgatttgcatgattttttcgtgaattacatcaaaa |
17980714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 28904190 - 28904142
Alignment:
| Q |
20 |
tgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28904190 |
tgtcttgctttgccgatttgcatgatttgttcgtgaattacatcaaaac |
28904142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 22501706 - 22501753
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
22501706 |
gatgtcttgctttgccgatttgcatgatttattcgtgaattacatcaa |
22501753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 14076995 - 14077045
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14076995 |
gatgtcttgcattgtcgatttgcatgatttcttcatgaattacatcaaaac |
14077045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 24381548 - 24381502
Alignment:
| Q |
21 |
gtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
24381548 |
gtcttgctttgccgatttgcatgatttcttcgtgaattacatcaaaa |
24381502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 14271713 - 14271760
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| ||||||||||||| |
|
|
| T |
14271713 |
gatgtcttgctttgccaatttgcatgatttcttcgtgaattacatcaa |
14271760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 24851165 - 24851119
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
24851165 |
tcttgctttgccgatttgcatgatttatttgtgaattacatcaaaac |
24851119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 30487718 - 30487768
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
30487718 |
gatgtcttgttttgccgatatgcatgattttttcgtgaattacaacaaaac |
30487768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 24583392 - 24583347
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24583392 |
tcttgatttgccgatttgcatgattttttcgtgaattacttcaaaa |
24583347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Complemental strand, 19784999 - 19784956
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
19784999 |
ttgctttgtcgatttgcatgatttcttcgtgaattacatcaaaa |
19784956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 30117883 - 30117836
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| |||||||| |||| |
|
|
| T |
30117883 |
gatgtcttgctttgccaatttgcatgatttcttcgtgaattacctcaa |
30117836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 17835416 - 17835466
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
17835416 |
gatgtcttgctttactgatatgcatgattttttcgtgaattacaacaaaac |
17835466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 26829687 - 26829641
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
26829687 |
tcttgctttgccgatttgcatgatttcttcgtgaattatttcaaaac |
26829641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 35861686 - 35861636
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| ||| |||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
35861686 |
gatgttttgttttgccgatttgcatgatttctttgtgaattacatcaaaac |
35861636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 15058728 - 15058679
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||||| ||| | |||||||| ||||||||||||| ||||| |
|
|
| T |
15058728 |
gatgtcttgctttgctgatatacatgatttcttcatgaattacaacaaaa |
15058679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 15176652 - 15176607
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
15176652 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
15176607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 17649683 - 17649724
Alignment:
| Q |
27 |
ctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
17649683 |
ctttgccgatttgcatgatttcttcgtaaattacatcaaaac |
17649724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 17976119 - 17976160
Alignment:
| Q |
27 |
ctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
17976119 |
ctttgccgatttgcatgatttcttattgaattacatcaaaac |
17976160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 24388592 - 24388547
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
24388592 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
24388547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 26139664 - 26139709
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
26139664 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
26139709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 28858708 - 28858757
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||| ||||||||| || ||||||| ||| ||||||||||||||| |
|
|
| T |
28858708 |
gatgtcttgatttgccgatctgtatgatttcttcgtgaattacatcaaaa |
28858757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 29765613 - 29765568
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
29765613 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
29765568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 30832815 - 30832860
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
30832815 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
30832860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 20)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 20886742 - 20886791
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
20886742 |
atgtcttgctttgccgatttgcatgatttcttcgtgaattacatcaaaac |
20886791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 68
Target Start/End: Original strand, 3002928 - 3002979
Alignment:
| Q |
17 |
tgatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
3002928 |
tgatgttttgctttgccgatttgcatgatttcttcttgaattacatcaaaac |
3002979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 27853138 - 27853090
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
27853138 |
atgtcttgctttgccgatatgcatgatttcttcatgaattacaacaaaa |
27853090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 5509941 - 5509988
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
5509941 |
gatgtcttgcttttccgatttgcatgatttcttcgtgaattacatcaa |
5509988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 28326358 - 28326308
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
28326358 |
gatgtcttgcattgccgatttgcatgatttcttcgtcaattacatcaaaac |
28326308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 23054801 - 23054752
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
23054801 |
gatgtcttgcttttccgatttacatgatttcttcgtgaattacatcaaaa |
23054752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 26092777 - 26092826
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||| ||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
26092777 |
atgttttgctttaccgatttgcatgatttcttcttgaattacatcaaaac |
26092826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 31284125 - 31284080
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
31284125 |
tcttgctttgccgatttgcatgatttcttcgtcaattacatcaaaa |
31284080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 19388075 - 19388028
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
19388075 |
gatgtcttgctttcccgatttgaatgatttcttcgtgaattacatcaa |
19388028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 67
Target Start/End: Complemental strand, 34276654 - 34276615
Alignment:
| Q |
28 |
tttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
34276654 |
tttgccgatttgcatgattttttcgtgaattacttcaaaa |
34276615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 3114933 - 3114887
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
3114933 |
atgtcttgctttgtcgatttgcatgatttcttcgtgaataacatcaa |
3114887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 8881621 - 8881575
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
8881621 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
8881575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 19169931 - 19169977
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
19169931 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
19169977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 7208394 - 7208443
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||| | ||||||||||||| |
|
|
| T |
7208394 |
gatgttttgctttgtcaatttgcatgattttttcttaaattacatcaaaa |
7208443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 8115505 - 8115460
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
8115505 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
8115460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 19912455 - 19912500
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||| |||||| |
|
|
| T |
19912455 |
tcttgatttgccaatttgcatgatttcttcatgaattacttcaaaa |
19912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 20022038 - 20021993
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
20022038 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
20021993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 22246873 - 22246918
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||||||| | |||||||| ||| ||||||||||||||| |
|
|
| T |
22246873 |
tcttgctttgccgatatacatgatttcttcgtgaattacatcaaaa |
22246918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 23637484 - 23637533
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
23637484 |
gatgtcttgatttgtcgatttccatgatttattcgtgaattacatcaaaa |
23637533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 27073828 - 27073873
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
27073828 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
27073873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 27911943 - 27911987
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27911943 |
ttgctttgccgatttgcatgattttttcttgaattacatcaaaac |
27911987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 13134295 - 13134257
Alignment:
| Q |
30 |
tgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13134295 |
tgccgatttgcatgatttcttcatgaattacatcaaaac |
13134257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 14235509 - 14235459
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
14235509 |
gatgtcttgttttgccaatttgcatgatttcttcgtgaattacatcaaaac |
14235459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 22626378 - 22626332
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
22626378 |
atgtcttactttgccgatttgcatgatcttttcgtgaattacatcaa |
22626332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 22621668 - 22621713
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
22621668 |
tcttgctttgccaatttgcatgatttcttcgtgaattacatcaaaa |
22621713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 7881673 - 7881716
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
7881673 |
ttgctttgccaatttgcatgatttcttcgtgaattacatcaaaa |
7881716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 15811670 - 15811623
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| ||||||||||||| |
|
|
| T |
15811670 |
gatgtcttgcttttccaatttgcatgatttcttcgtgaattacatcaa |
15811623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 21848504 - 21848547
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
21848504 |
ttgctttgccgatttgcatgatttctttgtgaattacatcaaaa |
21848547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 35133756 - 35133803
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||| ||||||||||||| |
|
|
| T |
35133756 |
gatgtcttgctttgctgattttcatgatttcttcgtgaattacatcaa |
35133803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 17017057 - 17017007
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
17017057 |
gatgttttgatttgccgatttgcatgatttattcttggattacatcaaaac |
17017007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 21333288 - 21333242
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
21333288 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
21333242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 18734806 - 18734761
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
18734806 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
18734761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 22507595 - 22507550
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
22507595 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
22507550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 26101736 - 26101781
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| |||| |||||||||| |
|
|
| T |
26101736 |
tcttgctttgccaatttgcatgatttcttcgtgaactacatcaaaa |
26101781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 21)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 5047058 - 5047008
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
5047058 |
gatgtcttgatttgccgatttgcatgatttcttcgtgaattacatcaaaac |
5047008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 20175966 - 20176016
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
20175966 |
gatgtcttgctttgccgatttgcaaaatttcttcatgaattacatcaaaac |
20176016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 1732543 - 1732592
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
1732543 |
gatgttttgctttgccgatttgcatgattttgtcttgaattacatcaaaa |
1732592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 10332276 - 10332325
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10332276 |
gatgtcttgttttgccgatatgcatgatttcttcatgaattacatcaaaa |
10332325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 10418429 - 10418478
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
10418429 |
gatgtcttgctttgccgatttgcatgatttcttcgtgaattacataaaaa |
10418478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 2507035 - 2506985
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
2507035 |
gatgtcttgctttgctgatttgcatgatttcttcgtgaattagatcaaaac |
2506985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 1254919 - 1254870
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||| |||||||||||||||| |
|
|
| T |
1254919 |
atgtcttgctttgtcgatttgcttgatttcttcgtgaattacatcaaaac |
1254870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 1586065 - 1586112
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
1586065 |
gatgtcttgatttgccgatttgcatgatttcttcgtgaattacttcaa |
1586112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 63
Target Start/End: Complemental strand, 15170986 - 15170943
Alignment:
| Q |
20 |
tgtcttgctttgccgatttgcatgattttttcatgaattacatc |
63 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
15170986 |
tgtcttgctttgccgatttacatgatttcttcgtgaattacatc |
15170943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 2505715 - 2505765
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| || ||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
2505715 |
gatgtttttctttgacgatttgcatgatttcttcttgaattacatcaaaac |
2505765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 5237087 - 5237041
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
5237087 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
5237041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 6039522 - 6039473
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| || |||||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
6039522 |
gatgtattactttgccgatatgcatgagtttttcgtgaattacatcaaaa |
6039473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 18986965 - 18986920
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
18986965 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
18986920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 19001593 - 19001548
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
19001593 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
19001548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 21502730 - 21502775
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
21502730 |
tcttgctttgtcgatttgcatgatttcttcgtgaattacctcaaaa |
21502775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 24751421 - 24751372
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||| |||||||| ||||||||||| ||| ||| |||||||||||||||| |
|
|
| T |
24751421 |
atgttttgctttgtcgatttgcatggtttcttcgtgaattacatcaaaac |
24751372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 5221193 - 5221153
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaatt |
58 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
5221193 |
gatgtcttgctttgccgatatgcatgatttcttcgtgaatt |
5221153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 60
Target Start/End: Complemental strand, 5471949 - 5471913
Alignment:
| Q |
24 |
ttgctttgccgatttgcatgattttttcatgaattac |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
5471949 |
ttgctttgccgatttgcatgatttcttcttgaattac |
5471913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 19154708 - 19154756
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatga-ttttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
19154708 |
gatgtcttactttgccaatttgcatgatttttttcgtgaattacatcaa |
19154756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 20577386 - 20577426
Alignment:
| Q |
28 |
tttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
20577386 |
tttgccgatttgcatgatttcttcgtgaattacttcaaaac |
20577426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 20754107 - 20754155
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatga-ttttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
20754107 |
gatgtcttactttgccaatttgcatgatttttttcgtgaattacatcaa |
20754155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 15)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 15520843 - 15520896
Alignment:
| Q |
15 |
tctgatgtctt-gctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
15520843 |
tctgatgtctttgctttgccgatttgcatgatttcttcttgaattacatcaaaa |
15520896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 18832094 - 18832141
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
18832094 |
gatgtattgctttgccgatttgcatgatttcttcgtgaattacatcaa |
18832141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 18939392 - 18939439
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
18939392 |
gatgtcttgctttgtcgatttgcatgatttcttcgtgaattacatcaa |
18939439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 24658520 - 24658473
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaact |
69 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
24658520 |
tcttgatttgccgatttgcatgatttcttcatgaattacttcaaaact |
24658473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 18227484 - 18227534
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
18227484 |
gatgtcttgctttgctgatttgcatgatttcttcgtgaattacatctaaac |
18227534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 28254763 - 28254813
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
28254763 |
gatgtcttgctttgccaatttgcatgatttcttcgtgaattgcatcaaaac |
28254813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 26 - 68
Target Start/End: Original strand, 28280162 - 28280204
Alignment:
| Q |
26 |
gctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28280162 |
gctttgccgatttgcatgatttcttcttgaattacatcaaaac |
28280204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 17336549 - 17336500
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
17336549 |
atgttttgttttgccgatttgcatgatttattcttgaattacatcaaaac |
17336500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 68
Target Start/End: Original strand, 26253354 - 26253391
Alignment:
| Q |
31 |
gccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26253354 |
gccgatttgcatgattttttcgtgaattacatcaaaac |
26253391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 31600300 - 31600251
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| | |||||||| |||| |
|
|
| T |
31600300 |
gatgtcttgctttgccgatttgcatgatttcttcgtaaattacataaaaa |
31600251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 16522125 - 16522079
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| ||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
16522125 |
tcttgattttccgatttgcatgatttcttcatgaattacttcaaaac |
16522079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 26348314 - 26348364
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||| ||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
26348314 |
gatgtcttgattttccaatttgcatgatttcttcgtgaattacatcaaaac |
26348364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 17469783 - 17469734
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||| |||||||| |||||| |
|
|
| T |
17469783 |
gatgccttgctttgcctatttgcatgatttcttcgtgaattacttcaaaa |
17469734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 19003986 - 19003941
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
19003986 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
19003941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 32416054 - 32416006
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
32416054 |
atgttttgttttgccgatttgcatgattttgccttgaattacatcaaaa |
32416006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 18971000 - 18970949
Alignment:
| Q |
15 |
tctgatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaa |
66 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
18971000 |
tctgatgtcttgctttgccggattgcatgatttcttcgtgaattacatcaaa |
18970949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 32141616 - 32141566
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
32141616 |
gatgtcttgttttgccgatttgcatgatttcttcgtgaatttcatcaaaac |
32141566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 8445698 - 8445649
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| ||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
8445698 |
gatgttttgctttgccgatttgcataatttcttcttgaattacatcaaaa |
8445649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 22627258 - 22627307
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| ||||||||| |||||| |
|
|
| T |
22627258 |
atgtcttgctttgccgatatgcatgatttcttcgtgaattacaacaaaac |
22627307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 26651859 - 26651810
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||||| |||||| |
|
|
| T |
26651859 |
atgtcttgctttgccgatatgcataatttcttcatgaattacaacaaaac |
26651810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 27871158 - 27871207
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||| |||||||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
27871158 |
atgttttgctttgccgatttgcatgatttctccttgaattacatcaaaac |
27871207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 29717580 - 29717531
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| ||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
29717580 |
gatgtattgctttgccgatttgcattatttcttcgtgaattacatcaaaa |
29717531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 34579994 - 34579949
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
34579994 |
tcttgctttgccgatttgcatgatttcttcgtgaattacataaaaa |
34579949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 34585743 - 34585698
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
34585743 |
tcttgctttgccgatttgcatgatttcttcgtgaattacataaaaa |
34585698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 32140734 - 32140694
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaatta |
59 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
32140734 |
atgtcttgttttgccgatttgcatgatttcttcatgaatta |
32140694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 8501735 - 8501685
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
8501735 |
gatgtctttctttgtcgatttgcatgatttatttgtgaattacatcaaaac |
8501685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 24086527 - 24086481
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
24086527 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
24086481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 25537432 - 25537478
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
25537432 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
25537478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 25922481 - 25922527
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
25922481 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaac |
25922527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 32138134 - 32138088
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
32138134 |
tcttgttttgccgatttgcatgatttcttcgtgaattacgtcaaaac |
32138088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 21905602 - 21905647
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
21905602 |
tcttgatttgctgatttgcatgatttcttcatgaattacttcaaaa |
21905647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 25196487 - 25196532
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
25196487 |
tcttgatttgccgatttgcttgattttttcgtgaattacttcaaaa |
25196532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 27907743 - 27907698
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
27907743 |
tcttgatttgccgatttgcatgatttcttcgtgaattacttcaaaa |
27907698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 32130924 - 32130875
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| |||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
32130924 |
atgtcttgttttgccgatttgtatgatttctttgtgaattacatcaaaac |
32130875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 28930156 - 28930196
Alignment:
| Q |
28 |
tttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
28930156 |
tttgccgatttgcatgatttcttcgtgaattacttcaaaac |
28930196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 88661 - 88614
Alignment:
| Q |
18 |
gatgtcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
88661 |
gatgtcttgcattgccgatttgcatgatttctttgtgaattacatcaa |
88614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 202053 - 202010
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaa |
65 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
202053 |
tcttgctttgtcgatttgcatgatttctccatgaattacatcaa |
202010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 95499 - 95545
Alignment:
| Q |
21 |
gtcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
95499 |
gtcttggtttgccgatttgcatgatttcttcgtgaattacttcaaaa |
95545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0441 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0441
Description:
Target: scaffold0441; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 2186 - 2141
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||| |||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
2186 |
tcttgcattgccgatttacatgatttcttcgtgaattacatcaaaa |
2141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 38164 - 38213
Alignment:
| Q |
19 |
atgtcttgctttgccgatttgcatgattttttcatgaattacatcaaaac |
68 |
Q |
| |
|
|||||||| ||| ||||||||| |||||| ||| |||||||||||||||| |
|
|
| T |
38164 |
atgtcttgtttttccgatttgcgtgatttcttcgtgaattacatcaaaac |
38213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 244051 - 244006
Alignment:
| Q |
22 |
tcttgctttgccgatttgcatgattttttcatgaattacatcaaaa |
67 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
244051 |
tcttgctttgacgatttgcatgatttctttgtgaattacatcaaaa |
244006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University