View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18383_low_1 (Length: 567)
Name: NF18383_low_1
Description: NF18383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18383_low_1 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 9e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 441 - 567
Target Start/End: Original strand, 34306697 - 34306819
Alignment:
| Q |
441 |
agtaatgatggagtttgatcctttcactcgtgcgtgccatatatgtactgaaagaagacacactctgtgattttactatcaaaatctatgcatgcaacat |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306697 |
agtaatgatggagtttgatcctttcactcgtg----ccatatatgtactgaaagaagacacactatgtgattttactatcaaaatctatgcatgcaacat |
34306792 |
T |
 |
| Q |
541 |
gtcattcactttgatacttctgtgctg |
567 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34306793 |
gtcattcactttgatacttctgtgctg |
34306819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 34306129 - 34306173
Alignment:
| Q |
21 |
taccttcctacttatgtcttaagtcgtagttttatctattatagt |
65 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34306129 |
taccttcctacttatgtcttaagttgtagttttatctattatagt |
34306173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University