View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18384_low_30 (Length: 254)

Name: NF18384_low_30
Description: NF18384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18384_low_30
NF18384_low_30
[»] chr3 (1 HSPs)
chr3 (161-250)||(26610075-26610164)
[»] chr4 (1 HSPs)
chr4 (1-68)||(5957666-5957733)


Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 161 - 250
Target Start/End: Complemental strand, 26610164 - 26610075
Alignment:
161 ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggttttg 250  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||    
26610164 ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttg 26610075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 5957733 - 5957666
Alignment:
1 tatatatctgggtccattggaaactcgtgcacacgcaccgtaggtagaaactccctctgtgctgctcc 68  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
5957733 tatatatctgggtccattggaaactcctgcacacgcaccgtaggtagaaactccctctgtgctgctcc 5957666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University