View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18386_high_13 (Length: 248)
Name: NF18386_high_13
Description: NF18386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18386_high_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 41675011 - 41675249
Alignment:
| Q |
10 |
tatactagcaaacattgatgatctctttgaatactcacacactctcactaacttctcttctctcttattatcacagtacccnnnnnnnccctacacacaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41675011 |
tatactagcaaacattgatgatctctttgaatactcacacactctcactaacttctcttctctcttattatcacagtaccctttttttccctacacacaa |
41675110 |
T |
 |
| Q |
110 |
ataaagaatcagttgcatagtgtgaaagctagctagttttggatattactatacaatttcttatggatgagaagagaaagacaagttccaagtcattgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41675111 |
ataaagaatcagttgcatagtgtgaaagctagctagttttggatattactatacaatttcttatggatgagaagagaaagacaagttccaagtcattgtt |
41675210 |
T |
 |
| Q |
210 |
ctcaaggagttcctcaacaagaagctcaacttcaaactc |
248 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41675211 |
ctcaaggagttcctcaacaagaagctctacttcaaactc |
41675249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University