View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18386_low_11 (Length: 343)
Name: NF18386_low_11
Description: NF18386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18386_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 21 - 327
Target Start/End: Complemental strand, 3570619 - 3570310
Alignment:
| Q |
21 |
atcaatgtcaaaactcaaacccattattataatggtaatctaatataaacccacgagcctggcccaccaaccgaccatatgctaaggaatgcggatgaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570619 |
atcaatgtcaaaactcaaacccattattataatggtaatctaatataaacccacgagcctggcccaccaaccgaccatatgctaaggaatgcggatgaga |
3570520 |
T |
 |
| Q |
121 |
tacttctccttatacaatgtcnnnnnnncttaacaaaaaggggctcaagcctaga---ctccaacagagacataaaactgaatagtttacgtataattaa |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570519 |
tacttctccttatacaatgtctttttttcttaacaaaaaggggctcaagcctagagtactccaacagagacataaaactgaatagtttacgtataattaa |
3570420 |
T |
 |
| Q |
218 |
attttccattgatgttcaaaataaagatcattatatttagtctgaaaattttagtgcagaccggttttatttatggacccccaactgttataccatttat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570419 |
attttccattgatgttcaaaataaagatcattatatttagtctgaaaattttagtgcagaccggttttatttatggacccccaactgttataccatttat |
3570320 |
T |
 |
| Q |
318 |
agcatgcttt |
327 |
Q |
| |
|
|||||||||| |
|
|
| T |
3570319 |
agcatgcttt |
3570310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University