View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18387_high_17 (Length: 268)
Name: NF18387_high_17
Description: NF18387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18387_high_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 157 - 268
Target Start/End: Complemental strand, 15115261 - 15115151
Alignment:
| Q |
157 |
ttctccccatttcccagcaaacccatcccatcgcagcaatgcgcttcaccatcttctccctccgccacaccaccgctactgcccaccgccaccatctccg |
256 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15115261 |
ttctccccatttcccagcaa-cccatcccatcgcagcaatgcgcttcaccatcttctccctccgccacaccacccctactgcccaccgccaccatctccg |
15115163 |
T |
 |
| Q |
257 |
cactctcttctc |
268 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15115162 |
cactctcttctc |
15115151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University